NEW ZEALAND TARANAKI

DNA and genetic engineering

AgResearch New Zeland is using our technique in classrooms and teaching it to science technicians across the nation ...

Find out how to extract your own DNA at home!

(featured in the New Zealand Science Teacher journal, No 103, 2003. ISSN 0110-7801)


If someone gave you some salt, flour, citric acid, icing sugar, milk powder, baking soda, and fruit drink powder from the kitchen, would you know how to make Sherbet? Simply mixing all these ingredients together will produce nothing but a sticky mess!

You can't make something useful without a recipe, just like you can't build a living thing without a plan. If you are feeling hungry, have a break using the recipe here

DNA - THE RECIPE FOR LIFE:

Back to our lesson...think of a whole organism such as yourself...what makes you human? You, a human, can be thought of as being made up of smaller pieces...a number of different organs.

Some of your organs are the brain, skin, the liver, kidneys, muscles, etc So what are organs made up of? Specialised cells.

Muscles are made up of muscle cells, the skin is made up of skin cells, and so on. How does a skin cell know how to be a skin cell? It has a set of instructions of how to be one, instructions stored on chromosomes.

A human will never really have kittens because we don't have the instructions of how to make cat cells! A seed knows what type of plant it should look like because it has the set of instructions to make all the organs (leaves, roots, etc) it requires to look like the parent plant.

The plan is stored on thread-like chromosomes, made of a chemical called DNA. We can get the DNA plan out of cells and study it, change it or swap it!

 

 

To isolate plant DNA
  • blend 50g of Cauliflower in 200 mL of water for 30 seconds to get single cells.
  • Strain through muslin cloth. Pour 15 mL of liquid into a screw cap tube with 3 drops of detergent and shake gently for 5 seconds.
  • Carefully layer to top of tube with cold alcohol (or meths). Use a hooked glass rod to spool out strands of DNA at the interface.

 

To isolate your own human DNA

(an original protocol independantly developed by Nexus, please acknowledge our contribution if using this protocol for teaching purposes)

  • To a 1/2 cup of water dissolve about 1/2 teaspoon of salt and add a squirt of dish-washing detergent. Save this for step 3
  • Swirl about 25 mls of water around your mouth for 30 seconds. This removes some cheek cells. Spit into a disposable cup
  • Add about 2cm of the fluid to a test-tube (or a Fuji film cannister) and add about 1cm of the saline/detergent solution. Invert gently 3 or 4 times to mix well (but you don't want a lot of froth). This will break open the many cheek cells you spat out, releasing the DNA message that each cell must carry.
  • Layer on top some ice cold ethanol (or methanol). Strands of DNA will be seen where the two layers meet. Hook out the strands of DNA that form with a glass hook (or one made from a plastic twist-tie) by slowly dipping up and down through the two layers.

CHEMICAL TESTS TO CONFIRM THE PRESENCE OF DNA:-

The following chemical tests can be used to check you actually have DNA:

  • Test for purines: Add excess 2M ammonia solution and a few drops of 0.1M silver nitrate to 1 mL of DNA extract. A white precipitate indicates the presence of purines.
  • Test for phosphate: Add 1 mL of 0.2M ammonium molybdate (39.02g/L) to 0.5 mL of extracted DNA and warm gently at 60-70oC. DO NOT BOIL. Yellow colour indicates presence of phosphate.
  • Test for deoxyribose: Add 2 mL of Disches reagent to 1 mL of extracted DNA. Boil in water bath for 15 minutes. Green-blue colour indicates presence of deoxyribose. Disches reagent: 486 mL glacial acetic acid, 14 mL conc. sulphuric acid, 5g diphenylamine. Stir well and add 500 mL distilled water

GENETIC ENGINEERING:-

SWAPPING RECIPES: DeoxyriboNucleic Acid (DNA) is the chemical message cells read to know what to do. Change the message and you change the type of cell....change the cell and you change the organ...change the organ and you change the whole organism. If the DNA from a luminescent jellyfish is inserted into the DNA plan of a mouse it could glow in the dark. This has actually been done! This creature is now both jellyfish and mouse...a totally new lifeform through genetic engineering.

DNA is made up of a series of only four compounds; Adenine, Guanine, Thymine and Cytosine; an example is: CAGATTCCAAACCGGGGGTTC;  a unique piece of DNA "code" to tell the cell what to do.  The code is read in sets of three:-

CAG ATT CCA AAC CGG GGG TTC with each 3 letter combination telling the cell which one of the amino acids to use in assembling PROTEINS the cell uses for work (enzymes), its structure or shape, communication, movement, colour, etc. This simple set of four bases read in groups of three allows for an almost infinite number of different proteins to be made; an infinite number of different cells. All bacteria, viruses, fungi, plants and animals use this same code. We can swap DNA from one lifeform to another and it will be read!

NATURES GENETIC ENGINEERS - VIRUSES: Viruses do not follow the MRSGREN characteristics of living things. Scientists say that a living thing must do 7 things: move, reproduce, sense the environment, grow in size, respire, excrete wastes and use nutrients. Viruses do not sense the environment, do not grow in size, do not carry out respiration, do not make wastes, and do not consume food. A virus is simply a piece of DNA (or RNA - Ribonucleic Acid) that is wrapped in a protein coat. This is called the virus particle. Remember the points above about MRSGREN. We say viruses are living in the loosest sense because they can reproduce: A particle attaches itself to or enters a living cell. The DNA or RNA is released into the cell The cell can’t tell the difference between its original DNA instructions and the new ones. It follows the new ones. New virus particles are assembled by the cell until it is so full (about 100 to 1000) that it bursts and dies. Each new particle will infect other cells.

Any drug that is used to stop viruses reproducing must stop the host cell reproducing - even the healthy ones! That is why there has never been a drug that can cure viral diseases. Viruses have very short pieces of DNA or RNA (about 1000 to 9000 bases compared to billions in plants or animals). Any change to the DNA or RNA (a mutation) caused by sunlight, chemicals, or copying errors in cells have a significant impact on how the virus behaves. It is estimated in a 24 hour period one strain of virus can mutate into 300 - 3000 different new strains. It may be possible that two different viruses may infect the same host without causing symptoms and form a hybrid eg, each year we see new strains of Flu virus that seem to be part bird virus and part human virus.


FIND OUT MORE:-

  1. Create a "fingerprint" using electric fields via electrophoresis
  2. We used professional research equipment for Crime Scene Investigation...

GeneE

In 2006 Michael created a DNA Fingerprinting and DNA sequencing simulator that can also download and run real DNA sequences from the NCBI Genbank database! It even reads the sequence out loud...cool!

Identify which child is adopted in a family of five, or which disease organism is in a patient sample or identify which suspect was at the crime scene. Each time the application is run a unique set of prints is generated. GeneE is fast and full of features yet it fits on a floppy disk!

Don't forget to visit our other pages at left and school / university projects at right

RETURN TO FUN! Science page

 

 

up arrow back to top  

Home | Search | About Us | Science Fair ideas | Downloads | Gifted children | Teachers resources | NRG courses/workshops | NRG publications/papers | NRG technical data

         All rights reserved